alerta Si el documento se presenta incompleto en el margen derecho, es que contiene tablas que rebasan el ancho predeterminado. Si es el caso, haga click aquí para visualizarlo correctamente.
 
DOF: 14/03/2018
PROYECTO de Norma Oficial Mexicana PROY-NOM-169-SEMARNAT-2018, Que establece las especificaciones de marcaje para los ejemplares, partes y derivados de totoaba (Totoaba macdonaldi), provenientes de Unidades de Manejo para la Conservación de Vida Silvestr

PROYECTO de Norma Oficial Mexicana PROY-NOM-169-SEMARNAT-2018, Que establece las especificaciones de marcaje para los ejemplares, partes y derivados de totoaba (Totoaba macdonaldi), provenientes de Unidades de Manejo para la Conservación de Vida Silvestre.

Al margen un sello con el Escudo Nacional, que dice: Estados Unidos Mexicanos.- Secretaría de Medio Ambiente y Recursos Naturales.

CUAUHTÉMOC OCHOA FERNÁNDEZ, Subsecretario de Fomento y Normatividad Ambiental de la Secretaría de Medio Ambiente y Recursos Naturales y Presidente del Comité Consultivo Nacional de Normalización de Medio Ambiente y Recursos Naturales, con fundamento en los artículos 32 Bis, fracciones I, IV y V de la Ley Orgánica de la Administración Pública Federal; 5o., fracción V, 36, fracciones I y II, 37, 37 TER, 79, fracciones I, II, III y IV, 83, 84, 86 y 94 de la Ley General del Equilibrio Ecológico y la Protección al Ambiente; 5, fracción II, 9, fracción V, 40, 51 y 55 de la Ley General de Vida Silvestre; 54 del Reglamento de la Ley General de Vida Silvestre; 38, fracción II, 40, fracciones X y XII, 41, 43, 44, 45, 46 y 47, fracción I de la Ley Federal sobre Metrología y Normalización; 30, 33 y 38 del Reglamento de la Ley Federal sobre Metrología y Normalización y, 8, fracciones III, IV y V del Reglamento Interior de la Secretaría de Medio Ambiente y Recursos Naturales, y
CONSIDERANDO
Que la totoaba (Totoaba macdonaldi) es un pez endémico del Golfo de California, de la familia Sciaenidae, clasificado bajo la categoría de riesgo "en peligro de extinción" por la "Norma Oficial Mexicana NOM-059-SEMARNAT-2010, Protección ambiental-Especies nativas de México de flora y fauna silvestres-Categorías de riesgo y especificaciones para su inclusión, exclusión o cambio-Lista de especies en riesgo"; e incluido en la "Lista de especies y poblaciones prioritarias para la conservación".
Que la totoaba (Totoaba macdonaldi), es un pez altamente valorado en el mercado asiático por su vejiga natatoria (conocida como buche), al que se le atribuyen diversas propiedades afrodisiacas y curativas, lo que ha incrementado su captura ilegal utilizando redes de enmalle donde también es atrapada incidentalmente la vaquita marina (Phocoena sinus), especie que comparte el hábitat de la totoaba (Totoaba macdonaldi), y que también se encuentra en peligro de extinción conforme a la NOM-059-SEMARNAT-2010, hecho que ha resultado en una drástica disminución de las poblaciones de dichas especies.
Que en el marco de los diversos instrumentos internacionales, como la Convención sobre el Comercio Internacional de Especies Amenazadas de Fauna y Flora Silvestres (CITES) y la Comisión Ballenera Internacional (CBI), y que además está calificado como una especie "en peligro crítico" en la Lista Roja de la Unión Internacional de la Conservación de la Naturaleza (IUCN, por sus siglas en inglés), se ha instado a nuestro país a implementar acciones para desincentivar el comercio ilegal de la totoaba (Totoaba macdonaldi) para realizar una protección más estricta de la vaquita marina (Phocoena sinus).
Que el Plan Estratégico para la Diversidad Biológica 2011-2020 del Convenio sobre la Diversidad Biológica, señala en la Meta 12 de Aichi que para el año 2020 se habrá evitado la extinción de especies en peligro identificadas y su estado de conservación se habrá mejorado y sostenido, especialmente para las especies en mayor declive.
Que para la protección de la totoaba (Totoaba macdonaldi) y de la vaquita marina (Phocoena sinus), el Gobierno Federal ha implementado diferentes medidas regulatorias enfocadas principalmente al establecimiento de restricciones sobre áreas y artes de pesca; a dichas medidas se han sumado disposiciones penales y administrativas desde vedas hasta el fortalecimiento de la inspección y vigilancia.
Que desde el 10 de abril de 2015 el Gobierno Federal acordó suspender el uso de redes de enmalle, cimbras y/o palangres en la pesca comercial con embarcaciones menores en un polígono de 1,263.77 km2 en el Norte del Golfo de California con objeto de proteger a la vaquita marina (Phocoena sinus), que como se refiere anteriormente, comparte hábitat con la totoaba (Totoaba macdonaldi); esta suspensión se encuentra vigente a través del "Acuerdo por el que se prohíben artes, sistemas, métodos, técnicas y horarios para la realización de actividades de pesca con embarcaciones menores en aguas marinas de jurisdicción federal de los Estados Unidos Mexicanos en el Norte del Golfo de California, y se establecen sitios de desembarque, así como el uso de sistemas de monitoreo para dichas embarcaciones", publicado en el Diario Oficial de la Federación el 30 de junio de 2017.
Que el Gobierno Federal implementa el Programa Interinstitucional para la Recuperación de Redes Fantasma con objeto de retirar las artes de pesca abandonadas en la zona del Alto Golfo de California, mismas que inciden en la captura de totoaba (Totoaba macdonaldi) y vaquita marina (Phocoena sinus). Este Programa es operado por la Procuraduría Federal de Protección al Ambiente en coordinación con la Secretaría de Marina, la Comisión Nacional de Áreas Naturales Protegidas, y la Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación por conducto de la Comisión Nacional de Acuacultura y Pesca.
Que la Procuraduría Federal de Protección al Ambiente ha detectado importantes cargamentos de partes de totoaba (Totoaba macdonaldi) que no demuestran su legal procedencia.
Que las Unidades de Manejo para la Conservación de Vida Silvestre (UMA) tienen como objetivo general la conservación del hábitat natural, poblaciones y ejemplares de especies silvestres; y entre sus objetivos específicos incluye los de reproducción, repoblación, reintroducción y aprovechamiento sustentable; mismos que cumplen las UMA de totoaba (Totoaba macdonaldi) al realizar una actividad productiva sustentable que contribuye a la conservación de las poblaciones en vida libre.
Que, en los últimos meses, se ha incrementado significativamente la solicitud de Registro de Unidades de Manejo para la Conservación de Vida Silvestre para el manejo intensivo y aprovechamiento sustentable de la totoaba (Totoaba macdonaldi).
Que de acuerdo con la Ley General de Vida Silvestre y su Reglamento, para demostrar la legal procedencia de los ejemplares, partes y derivados de vida silvestre que se encuentra fuera de su hábitat natural, es necesario incorporar medidas estandarizadas para su marcaje; lo cual permite identificar que provienen de un aprovechamiento sustentable y contar con elementos para tener un seguimiento, verificación y medios de control con fines de trazabilidad; facilitando a su vez las acciones de inspección y vigilancia por parte de la autoridad.
Que las consideraciones referidas en los párrafos inmediatos anteriores, fortalecen la legalidad de las acciones comerciales y no comerciales ligadas al aprovechamiento sustentable de la vida silvestre.
Que el Artículo VII de la Convención sobre el Comercio Internacional de Especies Amenazadas de Fauna y Flora Silvestres (CITES), referente a las Exenciones y otras disposiciones especiales relacionadas con el comercio, establece en el número 4. que "Los especímenes de una especie animal incluida en el Apéndice I y criados en cautividad para fines comerciales, o de una especie vegetal incluida en el Apéndice I y reproducidos artificialmente para fines comerciales, serán considerados especímenes de las especies incluidas en el Apéndice II", siendo este el caso de la totoaba (Totoaba macdonaldi); y siempre que se cumpla con el proceso de registro de establecimientos que crían en cautividad especies de fauna incluidas en el Apéndice I con fines comerciales, como se indica en la Resolución Conf. 12.10 (Rev. CoP15) de la CITES.
Que con fecha 22 de agosto de 2017 se publicó en el Diario Oficial de la Federación la Norma Oficial Mexicana de Emergencia NOM-EM-169-SEMARNAT-2017, Que establece las especificaciones de marcaje para los ejemplares, partes y derivados de totoaba (Totoaba macdonaldi) provenientes de Unidades de Manejo para la Conservación de Vida Silvestre, misma que fue prorrogada mediante Aviso publicado en el mismo periódico oficial el 23 de febrero de 2018.
Que las especificaciones contenidas en la NOM-EM-169-SEMARNAT-2017 contribuyen a la conservación de totoaba (Totoaba macdonaldi), al implementar medidas para el marcaje de sus ejemplares, partes y derivados que provienen del aprovechamiento sustentable en UMA, a fin de demostrar su legal procedencia y evitar el comercio ilegal, a la vez que se contribuye a combatir la captura ilegal de ejemplares de vida libre utilizando redes de enmalle en donde también es atrapada incidentalmente la vaquita marina (Phocoena sinus).
Que con el antecedente que plantea la NOM-EM-169-SEMARNAT-2017, el presente Proyecto de Norma Oficial Mexicana da mayor claridad a sus usuarios al hacer la diferenciación entre las especificaciones generales, de aquellas que sólo aplican a las UMA o a los comercializadores; fortaleciendo las medidas para el marcaje de ejemplares ajustando las especificaciones de los documentos para demostrar la legal procedencia contempladas en la Norma de Emergencia, con énfasis en el uso del código de identificación único desde el origen en las UMA hasta el comercializador final, e incluyendo como un nuevo elemento el marcaje genético por genotipificación de los parentales con que cuentan las UMA, que permitirá identificar con certeza el origen de los ejemplares, partes y derivados de la totoaba (Totoaba macdonaldi).
Que dado que el cultivo de la totoaba (Totoaba macdonaldi) en UMA es una actividad en crecimiento ante la demanda tanto del mercado nacional como internacional de sus partes y derivados, se considera que es necesario contar con un instrumento regulatorio definitivo que establezca los medios para garantizar la legalidad del comercio de ejemplares, partes y derivados de dicha especie.
 
Que corresponde a la Secretaría de Medio Ambiente y Recursos Naturales emitir Normas Oficiales Mexicanas en materia ambiental, para garantizar la sustentabilidad de las actividades económicas y el aprovechamiento sustentable de los recursos naturales.
Que la publicación a consulta pública del Proyecto de Norma Oficial Mexicana PROY-NOM-169-SEMARNAT-2018, Que establece las especificaciones de marcaje para los ejemplares, partes y derivados de totoaba (Totoaba macdonaldi) provenientes de Unidades de Manejo para la Conservación de Vida Silvestre, fue aprobada por el Comité Consultivo Nacional de Normalización de Medio Ambiente y Recursos Naturales, en sesión celebrada el 23 de febrero de 2018, a efecto de que, de conformidad con el artículo 47, fracción I de la Ley Federal sobre Metrología y Normalización, dentro de los siguientes 60 días naturales posteriores a la fecha de su publicación, los interesados presenten sus comentarios ante el citado Comité sito en Avenida Ejército Nacional número 223, Piso 16, Colonia Anáhuac, Delegación Miguel Hidalgo, código postal 11320, Ciudad de México, teléfono 56 28 06 00 extensión 10928 o al correo electrónico marcaje.totoaba@semarnat.gob.mx.
Que durante el citado plazo, la Manifestación de Impacto Regulatorio correspondiente estará a disposición del público para su consulta en el domicilio señalado, de conformidad con el artículo 45 de la Ley Federal sobre Metrología y Normalización.
Que, en virtud de lo antes expuesto y fundado, expido el siguiente:
PROYECTO DE NORMA OFICIAL MEXICANA PROY-NOM-169-SEMARNAT-2018, QUE ESTABLECE LAS
ESPECIFICACIONES DE MARCAJE PARA LOS EJEMPLARES, PARTES Y DERIVADOS DE TOTOABA
(TOTOABA MACDONALDI) PROVENIENTES DE UNIDADES DE MANEJO PARA LA CONSERVACIÓN DE
VIDA SILVESTRE
Prefacio
En la elaboración del presente Proyecto de Norma Oficial Mexicana participaron las siguientes instancias:
·      Secretaría de Medio Ambiente y Recursos Naturales (SEMARNAT).
-      Dirección General del Sector Primario y Recursos Naturales Renovables.
-      Dirección General de Vida Silvestre.
-      Procuraduría Federal de Protección al Ambiente (PROFEPA).
-     Dirección General de Inspección Ambiental en Puertos Aeropuertos y Fronteras.
-     Dirección General de Inspección y Vigilancia de Vida Silvestre Recursos Marinos y Ecosistemas Costeros.
-      Comisión Nacional de Áreas Naturales Protegidas (CONANP).
-     Dirección de Especies Prioritarias para la Conservación.
-      Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO).
-     Dirección General de Cooperación Internacional e Implementación.
-      Delegación Federal de la SEMARNAT en el estado de Baja California.
-      Delegación Federal de la SEMARNAT en el estado de Baja California Sur.
·   Instituto Nacional de Pesca y Acuacultura (INAPESCA).
·   Universidad Autónoma de Baja California.
·   Earth Ocean Farms, S. de R.L. de C.V.
·   Instituto de Acuacultura del Estado de Sonora - Centro Reproductor de Especies Marinas del Estado de Sonora (IAES-CREMES).
·   Comercializadora El Sargazo S.A. de C.V.
·   Netmar S.A de C.V.
Índice del contenido
1.     Objetivo y campo de aplicación
 
2.     Referencias normativas
3.     Términos y definiciones
4.     Especificaciones
4.1  Especificaciones generales
4.2  Especificaciones aplicables a las UMA
4.3  Especificaciones aplicables a las comercializadoras.
5.     Procedimiento de Evaluación de la Conformidad
6.     Concordancia con Normas Internacionales
7.     Vigilancia de esta Norma Oficial Mexicana
8.     Bibliografía
       Transitorios
       Apéndice "A" normativo. Microsatélites para el marcaje genético por genotipificación.
1. Objetivo y campo de aplicación
La presente Norma Oficial Mexicana establece las especificaciones de marcaje de ejemplares, partes y derivados de totoaba (Totoaba macdonaldi) que provienen del aprovechamiento sustentable en las Unidades de Manejo para la Conservación de Vida Silvestre, para contar con elementos que permitan reconocer el movimiento que tienen desde la UMA hasta el comercializador final, es decir permitir su trazabilidad.
Es de observancia obligatoria para las personas físicas y morales que realicen actividades con fines comerciales y no comerciales de ejemplares, partes y derivados de la totoaba (Totoaba macdonaldi) en los Estados Unidos Mexicanos.
2. Referencias normativas
El siguiente documento referido es indispensable para la aplicación de esta Norma Oficial Mexicana, o el que lo sustituya:
NOM-059-SEMARNAT-2010,   Protección ambiental-Especies nativas de México de flora y fauna silvestres-Categorías de riesgo y especificaciones para su inclusión, exclusión o cambio-Lista de especies en riesgo. Publicada en el Diario Oficial de la Federación el 30 de diciembre de 2010.
3. Términos y definiciones
Para los propósitos de esta Norma Oficial Mexicana, se consideran las definiciones contenidas en la Ley General del Equilibrio Ecológico y la Protección al Ambiente, la Ley General de Vida Silvestre y su Reglamento, la Ley Federal sobre Metrología y Normalización y su Reglamento, así como las siguientes:
3.1 Comercializadora
Persona física o moral que realiza actividades de distribución y venta de ejemplares, partes y derivados de totoaba (Totoaba macdonaldi), y que no cuenten con un registro de UMA.
3.2 Ejemplar
Organismo perteneciente a la especie Totoaba macdonaldi (sinonimia Cynoscion macdonaldi), vivo o muerto, proveniente del aprovechamiento sustentable en Unidades de Manejo para la Conservación de Vida Silvestre.
3.3 Factura
Comprobante fiscal que sirve para demostrar la legal procedencia de ejemplares, partes y derivados de la vida silvestre, en el que se describen las condiciones de compra-venta.
3.4 Ley
Ley General de Vida Silvestre.
3.5 Marca
Distintivo que sirve como método de identificación para demostrar la legal procedencia de ejemplares, partes y derivados de la vida silvestre, aprobado por la Secretaría.
3.6 Marcaje genético por genotipificación
Caracterización de un conjunto de marcadores genéticos que porta un individuo, los cuales fueron heredados de sus progenitores y que serán heredados a su progenie.
3.7. Microsatélite
Región del ácido desoxirribonucleico (ADN) de un individuo que contiene unidades repetitivas de entre 1 y 6 pares de bases. La variabilidad de cada microsatélite, dentro y entre individuos, se refleja en el número de unidades de repetición o el tamaño de esta región de ADN.
3.8 Nota de remisión
Documento que demuestra la legal procedencia de ejemplares, partes y derivados de la vida silvestre, vinculado a actividades no comerciales.
3.9 PROFEPA
Procuraduría Federal de Protección al Ambiente.
3.10 Secretaría
Secretaría de Medio Ambiente y Recursos Naturales.
3.11 Trazabilidad
Serie de actividades técnicas y administrativas sistematizadas que permiten seguir el movimiento de ejemplares, partes y derivados de la vida silvestre, a través de etapas del nacimiento, crianza, engorda, reproducción, sacrificio, transporte, distribución y procesamiento.
3.12 Unidades de manejo para la conservación de vida silvestre (UMA)
Los predios e instalaciones registrados que operan de conformidad con un plan de manejo aprobado y dentro de los cuales se da seguimiento permanente al estado del hábitat y de poblaciones o ejemplares que ahí se distribuyen.
4. Especificaciones
4.1 Especificaciones generales
4.1.1 Toda persona física o moral que realice actividades de aprovechamiento sustentable de ejemplares de totoaba (Totoaba macdonaldi), sus partes y derivados, resultado de la reproducción controlada y/o engorda en condiciones de cautiverio o confinamiento en UMA, debe cumplir con las especificaciones de identificación de la legal procedencia contenidas en la presente Norma Oficial Mexicana, a fin de permitir su trazabilidad.
4.1.2 Toda persona física o moral que realice actividades de aprovechamiento sustentable de ejemplares de totoaba (Totoaba macdonaldi), sus partes y derivados provenientes de una UMA, debe contar en todo momento con los documentos que demuestren la legal procedencia y que permitan su trazabilidad.
4.1.3 Para los fines de la presente Norma Oficial Mexicana, la legal procedencia de los ejemplares, partes y derivados de totoaba (Totoaba macdonaldi) se demuestra con la autorización de aprovechamiento extractivo de ejemplares, partes y derivados de la vida silvestre; la factura o nota de remisión, según sea el caso, y con las marcas que se refieren en los numerales 4.2.2, 4.2.3 y 4.2.6, según sea aplicable; lo anterior, por tratarse de una especie en peligro de extinción de acuerdo con el Anexo Normativo III de la NOM-059-SEMARNAT-2010.
4.1.4 Tratándose de transacciones no comerciales, la factura o nota de remisión deben servir para demostrar la legal procedencia de los ejemplares, partes y derivados, siempre y cuando cumplan con las especificaciones de los numerales 4.2.5 o 4.3.2, según corresponda.
4.1.5 A toda persona física o moral que realice actividades de aprovechamiento sustentable de ejemplares de totoaba (Totoaba macdonaldi), sus partes y derivados, se recomienda contar con una bitácora, en la que se asentará la información relativa a los ingresos y egresos, asentando la siguiente información:
a)    Fecha de registro.
 
b)    Señalar si es ingreso o egreso.
c)    Especie.
d)    Cantidad.
e)    Descripción detallada de los ejemplares, partes y derivados.
f)     Código de identificación referido en el inciso c) del numeral 4.2.8.
g)    Número de folio de la factura o nota de remisión que lo ampara.
h)    Razón social del proveedor o cliente, a excepción de la venta de producto preparado para el consumo final al menudeo.
i)     Número y fecha del oficio de autorización de aprovechamiento extractivo de ejemplares, partes y derivados de la vida silvestre, expedido por la Secretaría.
j)     Observaciones, donde se tiene que asentar cualquier incidencia que pudiera afectar las existencias de ejemplares, partes y derivados.
4.1.6 La importación, exportación y reexportación de ejemplares, partes y derivados de totoaba (Totoaba macdonaldi) se debe llevar a cabo de acuerdo con la Convención sobre el Comercio Internacional de Especies Amenazadas de Fauna y Flora Silvestres.
Particularmente para la exportación de ejemplares, partes y derivados de especies en el Apéndice I de la CITES, es necesario que la UMA solicite, a través de la Autoridad Administrativa de México, su registro ante la Secretaría de la CITES, siguiendo el proceso y lineamientos de la Resolución Conf. 12.10 (Rev. CoP15) de la Convención, relativos al registro de establecimientos que crían en cautividad especies de fauna incluidas en el Apéndice I con fines comerciales.
4.2 Especificaciones aplicables a las UMA
4.2.1 Las personas físicas o morales que realicen actividades de reproducción controlada y/o engorda de organismos de la especie de totoaba (Totoaba macdonaldi) bajo manejo intensivo, deben contar con su Registro como Unidades de Manejo para la Conservación de Vida Silvestre y su Plan de Manejo previamente aprobado por la Secretaría; lo anterior de acuerdo a lo establecido en la Ley y su Reglamento, sin perjuicio de las demás disposiciones jurídicas aplicables y de conformidad con el Registro Federal de Trámites y Servicios.
4.2.2 Las UMA que realicen la reproducción controlada en cautiverio de la totoaba (Totoaba macdonaldi), deben contar con un marcaje genético por genotipificación de sus parentales, que brinde la información necesaria para la trazabilidad de su descendencia.
Para la incorporación de nuevos parentales a las UMA, se cuenta con un periodo de tiempo de 240 días naturales para realizar el marcaje genético referido. Adicionalmente deben contar con una muestra de material genético de los organismos reproductores, que debe ser almacenada y conservada en buenas condiciones, misma que debe estar a disposición de la Secretaría en caso de requerir realizar estudios para la trazabilidad genética.
Las UMA que realicen actividades comerciales o no comerciales de totoaba (Totoaba macdonaldi) cuyos ejemplares, partes o derivados sean objeto de comercialización deben poder demostrar el marcaje genético por genotipificación.
4.2.3 El marcaje genético por genotipificación referido en el numeral anterior debe realizarse con base a 24 microsatélites reportados en la literatura, los cuales se describen en el Apéndice "A" (normativo).
4.2.4 La factura de ejemplares, partes y derivados de la totoaba (Totoaba macdonaldi) expedida por una UMA debe contener la siguiente información:
a)    Número de folio fiscal de la factura.
b)    Número de Registro de la UMA.
c)    Datos del predio (Estado, Municipio y Nombre del predio).
d)    Especie.
e)    Código de identificación referido en el inciso c) del numeral 4.2.8.
f)     Número y fecha del oficio de autorización de aprovechamiento extractivo de ejemplares, partes y
derivados de la vida silvestre, expedido por la Secretaría.
g)    Nombre del titular de la UMA.
h)    Tasa autorizada
i)     Proporción de la tasa autorizada, señalando el número de lote, la cantidad de ejemplares, talla y peso; así como en qué condiciones se encuentran los ejemplares, partes y derivados (entero, eviscerado, fileteado, fresco, enhielado, congelado, seco, entre otros).
4.2.5 Tratándose de transacciones no comerciales podrá utilizarse una factura que cumpla con los requisitos del numeral 4.2.4 o una nota de remisión expedida por la UMA que contenga un número de folio consecutivo así como la información requerida en los incisos b) al i), del numeral 4.2.4.
4.2.6 Las UMA que realicen actividades con fines comerciales y no comerciales de ejemplares, partes y derivados de la totoaba (Totoaba macdonaldi), deben utilizar una marca consistente en una etiqueta que sea fácil de identificar, legible y visible, la cual tiene que ir adherida al contenedor, empaque, embalaje u otro que contenga a los ejemplares, partes y derivados referidos.
4.2.7 La marca debe ser de material e impresión resistentes a las condiciones de manejo, tales como humedad y cambios de temperatura. Se debe asegurar que el material de la marca no sea reutilizable, es decir, que no pueda retirarse intacta o transferirse a otro contenedor, empaque o embalaje.
4.2.8 La marca referida en el numeral 4.2.6 debe contener la siguiente información:
a)    Nombre de la UMA.
b)    Número de Registro de la UMA.
c)    Un código de identificación que estará conformado por la siguiente nomenclatura:
i.    Clave del país: MX.
ii.   Clave de la especie: TMA.
iii.   Clave que identifique que proviene de un aprovechamiento bajo manejo intensivo: IN.
iv.   Número consecutivo de la clave de registro de la UMA.
v.   Número de lote.
vi.   Mes y año del oficio de la autorización de aprovechamiento extractivo de ejemplares, partes y derivados de la vida silvestre. El mes se debe indicar con número romano.
       Ejemplo:

d)    Número de ejemplares o contenido.
e)    Descripción.
f)     Número consecutivo de la etiqueta de la UMA, el cual no debe repetirse.
4.3 Especificaciones aplicables a las comercializadoras.
4.3.1 La factura emitida por las comercializadoras para la venta de ejemplares, partes y derivados de totoaba (Totoaba macdonaldi), debe contener:
a)    Número de folio fiscal de la factura.
b)    Número y fecha del oficio de autorización de aprovechamiento extractivo de ejemplares, partes y derivados de la vida silvestre de la UMA de origen, expedido por la Secretaría.
c)    Nombre, denominación o razón social del comercializador.
d)    Domicilio fiscal.
 
e)    Código de identificación referido en el inciso c) del numeral 4.2.8.
f)     Número de ejemplares o contenido.
g)    Descripción de los ejemplares, partes y detallando en qué condiciones se encuentran (entero, eviscerado, fileteado, fresco, enhielado, congelado, seco, entre otros).
4.3.2 Tratándose de transacciones no comerciales podrá utilizarse una factura que cumpla con los requisitos del numeral 4.3.1 o la nota de remisión que debe contener un número de folio consecutivo así como la información requerida en los incisos b) al g) del numeral 4.3.1.
5. Procedimiento de Evaluación de la Conformidad
5.1 La Evaluación de la Conformidad de la presente Norma Oficial Mexicana, se debe realizar por el personal de la PROFEPA en los términos establecidos por la Ley Federal sobre Metrología y Normalización y su Reglamento para determinar el grado de cumplimiento de la presente regulación.
5.2. Para la importación, exportación y reexportación de ejemplares, partes o derivados de totoaba (Totoaba macdonaldi), el exportador o reexportador y/o agente aduanal o su representante debe presentarse con el personal oficial de la PROFEPA, el cual tiene que realizar la verificación conforme a lo establecido en el "Manual de procedimientos para la importación y exportación de vida silvestre, productos y subproductos forestales, y materiales y residuos peligrosos, sujetos a regulación por parte de la Secretaría de Medio Ambiente y Recursos Naturales".
6. Concordancia con Normas Internacionales
Esta Norma Oficial Mexicana no es equivalente (NEQ) con ninguna Norma Internacional, por no existir esta última al momento de su elaboración.
7. Vigilancia de esta Norma Oficial Mexicana
Corresponde a la Secretaría de Medio Ambiente y Recursos Naturales, por conducto de la PROFEPA la vigilancia en el cumplimiento de lo dispuesto por la presente Norma Oficial Mexicana, sin perjuicio de las atribuciones que puedan tener otras dependencias de la administración pública federal, estatal y municipal.
Las violaciones a la presente Norma Oficial Mexicana serán sancionadas de conformidad con lo dispuesto en la Ley General de Vida Silvestre y demás disposiciones jurídicas aplicables.
Apéndice "A"
(Normativo)
Microsatélites para el marcaje genético por genotipificación.
Microsatélite
Secuencia de los cebadores
Variantes
Intervalo de
tamaño de alelos
Referencia
Soc826
GGCAGGATTTAGGCAATTCA
6
183-211
Renshaw et al.
2012
 
ACACACTCCTGTGTGCAACC
18
 
 
 
 
 
 
 
Soc973
TCTTCATCCTGCTGTGAGTCC
13
187-225
Renshaw et al.
2012
 
CAGACAAAACTGGAAAATACAGAGG
19
 
 
 
 
 
 
 
Soc507
GCTGAGCAGAAAAGATGAGATAG
18
291379
Karlsson et al. 2008
 
CAGAGAGCCCAATGAAGGTC
 
 
 
 
 
 
 
 
 
Soc554
GAAAGTAGTCCAACATCCAAGT
21
204276
Karlsson et al. 2008
 
AAATGCCAGTTTTCTCAGG
 
 
 
 
 
 
 
 
Soc573
AGAGCAGGAGGATGTGACTTC
27
267329
Karlsson et al. 2008
 
CTTTCTGGGAGGTTCAGCACA
 
 
 
 
 
 
 
 
Soc609
CCCGCATTAGACAGAAAAC
24
281351
Karlsson et al. 2008
 
ATGGGTATGTGTGGCTTACAG
 
 
 
 
 
 
 
 
Soc403
AGGGAAATGGTTGGTGAAGTAG
11
273-311
O'Malley et al. 2003
 
GTCTGGACCTGTTTGTTGAGAG
 
 
 
 
 
 
 
 
Soc418
GTTTTTCTGGCATTTATGGATG
11
273-295
O'Malley et al. 2003
 
TGAGGTTATCAAACACCTGCCCACT
 
 
 
 
 
 
 
 
Soc430
TAACAGTCCCTAAACAGGTT
10
265-339
O'Malley et al. 2003
 
GTTTCTCCTCCCCTTTCCTC
 
 
 
 
 
 
 
 
 
Soc443
CACAGGAGGAGTTTGTCCAAT
11
206-242
O'Malley et al. 2003
 
ATGTTTCGGTTTTCGTTTGCTC
 
 
 
 
 
 
 
 
Tmac55
TGCAAAGCAGAAGAGAGGTG
9
166186
García de León et
al. 2010
 
TGAGCCCGTTTTGATGATCT
 
 
 
 
 
 
 
 
Cyne2*
GCGTGAGGAGCTAGGAATCA
18
255-295
Piller y Cordes
2011
 
AGCTGCAGAGAGACGCATTA*
 
 
 
 
 
 
 
 
Cyne12*
GACTCACACTTCATACGGCT
16
147-195
Piller y Cordes
2011
 
TTACTGTCACCTCCCGTTGG*
 
 
 
 
 
 
 
 
 
 
 
 
 
Tmac04
CTGTGTTGGCTTCTGTCA
9
168184
García de León et
al. 2010
 
ACTGAGCGGAAATGAAAA
 
 
 
 
 
 
 
 
 
Tmac05
ATTTCTCTGCTGGTGGTG
4
150156
García de León et
al. 2010
 
TCCATGCTGTAGAAATATGG
 
 
 
 
 
 
 
 
Tmac06a
ATTAAAGAAGAGTGCAGGAAC
14
144180
García de León et
al. 2010
 
TGTGTCTTTTGATGTGTTTGT
 
 
 
 
 
 
 
 
Tmac25
CACCAGTAATTTATGGTTAGAACA
15
142176
García de León et
al. 2010
 
GGGACTGCTGTTTCTGAT
 
 
 
 
 
 
 
 
Tmac44
ACAGAATGAGGGGCAGAGG
6
196216
García de León et
al. 2010
 
GCCACAAAGACACAATGCAG
 
 
 
 
 
 
 
 
Tmac51
GTTTTGCCTCTGCACACCTC
17
124162
García de León et
al. 2010
 
TTCTGCCAAGATGACAGCAC
 
 
 
 
 
 
 
 
Tmac74
ATCGATTTTCATCAACAGGT
23
116168
García de León et
al. 2010
 
GTCTTTCTCTCTGCGTTTCT
 
 
 
 
 
 
 
 
CacMic03
GAGTGACGTCCTCCCTTCTG
8
182198
Farias et al 2006
 
R-5'-GGTGAGTCTGAGCAGGAAGC
 
 
 
 
 
 
 
 
CacMic13
AGGATGGGATGGAGGAAGAG
8
160174
Farias et al 2006
 
R-5'-TACAGGGTTGTGCTCAGTGG
 
 
 
 
 
 
 
 
CacMic14
ATCTTCTCCCCTCCGTCACT
9
145161
Farias et al 2006
 
R-5'-CTGTGTTGTTAAGGCGCATC
 
 
 
 
 
 
 
 
CacMic18
GCTCGCCTCTCGTGTGTAAT
6
290302
Farias et al 2006
 
CCTGTGAAACAGCCCATGTA
 
 
 
 
8. Bibliografía
8.1 Álvarez Blanco M.L., Guía sobre trazabilidad e información alimentaria facilitada al consumidor final en productos Pesqueros y Acuícolas, Fedepesca, España, pp 52. [En línea]. Fecha de consulta: 21 de julio de 2017. Disponible en: http://fedepesca.org/wp-content/uploads/2014/12/GUIA-PESQUEROS-ACUICOLAS.pdf
8.2 Borit M. y Olsen P., 2016. Sistemas de rastreabilidad de productos alimentarios marinos: análisis de lagunas e incoherencias en las normas y criterios. FAO, Circular de Pesca y Acuicultura No 1123. Roma, pp 29.
8.3 Convención sobre el Comercio Internacional de Especies Amenazadas de Fauna y Flora Silvestres (CITES). Resolución Conf. 12.7 (Rev. CoP17). Conservación y comercio de esturiones y peces espátula. Disponible en https://cites.org/sites/default/files/document/S-Res-12-07-R17.pdf Fecha de consulta: 24 de julio de 2017.
8.4 Convención sobre el Comercio Internacional de Especies Amenazadas de Fauna y Flora Silvestres (CITES). Resolución Conf. 12.10 (Rev. CoP15). Registro de establecimientos que crían en cautividad especies de fauna incluidas en el Apéndice I con fines comerciales. Disponible en https://www.cites.org/sites/default/files/document/S-Res-12-10-R15.pdf
 
8.5 Comisión Europea, Guía de bolsillo sobre las nuevas etiquetas de la UE para los productos de la pesca y de la acuicultura, Oficina de Publicaciones, ISBN 978-92-79-43871-4, doi:10.2771/80625, pp 20. [En línea]. Fecha de consulta: 21 de julio de 2017. Disponible en: https://ec.europa.eu/fisheries/sites/fisheries/files/docs/body/eu-new-fish-and-aquaculture-consumer-labels-pocket-guide_es.pdf
8.6 Deere, Carolyn L., 1999. Eco-labelling and Sustainable Fisheries, IUCN: Washington, D.C. and FAO: Rome.
8.7 FAO, 2009. Directrices para el ecoetiquetado de pescado y productos pesqueros de la pesca de captura marina. Revisión 1. Roma.
8.8 Farias I., l. B. Muniz, S. Astolfi-filho and I. Sampaio (2006). Isolation and characterization of DNA microsatellite primers for Cynoscion acoupa, the most exploited sciaenid fish along the coast of Brazil. Molecular Ecology Notes 6:660-663.
8.9 García de León FJ, Valles-Jiménez R, Shaw K, Ward R, de-Anda-Montañez JA, Martínez-Delgado ME (2010) Characterization of fourteen microsatellite loci in the endemic and threatened totoaba (Totoaba macdonaldi) from the Gulf of California. Conservation Genetic Resources 2, 219-221.
8.10 Karlsson S, Renshaw MA, Rexroad CE III, Gold JR (2008) PCR primers for 100 microsatellites in red drum (Sciaenops ocellatus). Molecular Ecology Resources 8, 393-398.
8.11 O'Malley KG, Abbey CA, Ross K, y Gold, JR. 2003. Microsatellite DNA markers for kinship analysis and genetic mapping in red drum, Sciaenops ocellatus (Sciaenidae, Teleostei). Molecular Ecology Notes 3, 155-158.
8.12 Plataforma Tecnológica Española de la Pesca y la Acuicultura (PTEPA), 2012, Evolución de la I+D+i en Trazabilidad de los Productos Pesqueros y Acuícolas, España pp 24.
8.13 Renshaw M A, Hollenbeck Christopher M., and Gold John R. (2012). Isolation of microsatellite markers from red drum, Sciaenops ocellatus, and characterization in red drum and spotted seatrout, Cynoscion nebulosus Molecular Ecology resources 12, 570-572
8.14 UICN, 2017. The IUCN Red List of Threatened Species. Versión 2017-1. [En línea]. Disponible en www.iucnredlist.org. Fecha de consulta: 19 de julio de 2017.
8.15 Manual de procedimientos para la importación y exportación de vida silvestre, productos y subproductos forestales, y materiales y residuos peligrosos, sujetos a regulación por parte de la Secretaría de Medio Ambiente y Recursos Naturales. Publicado en el Diario Oficial de la Federación el 29 de enero de 2004.
8.16 Acuerdo por el que se da a conocer la lista de especies y poblaciones prioritarias para la conservación. Publicado en el Diario Oficial de la Federación el 5 de marzo de 2014.
TRANSITORIOS
PRIMERO.- La presente Norma Oficial Mexicana entrará en vigor a los sesenta días naturales posteriores a su publicación en el Diario Oficial de la Federación.
SEGUNDO.- Las UMA autorizadas por la Secretaría y en operación a la fecha de entrada en vigor de la presente Norma Oficial Mexicana, contarán con un plazo de treinta días naturales para dar cumplimiento a los requisitos de información de la marca dispuestos en el numeral 4.2.8 y con un plazo de 240 días naturales para dar cumplimiento al marcaje genético por genotipificación de los reproductores que tengan en existencia, conforme a lo establecido en los numerales 4.2.2 y 4.2.3.
TERCERO.- A efecto de dar cumplimiento al artículo quinto del Acuerdo que fija los lineamientos que deberán ser observados por las dependencias y organismos descentralizados de la Administración Pública Federal, en cuanto a la emisión de los actos administrativos de carácter general a los que les resulta aplicable el artículo 69-H de la Ley Federal de Procedimiento Administrativo, publicado en el Diario Oficial de la Federación el 8 de marzo del 2017, se derogan o abrogan las 2 obligaciones regulatorias especificadas en la Manifestación de Impacto Regulatorio correspondiente.
Ciudad de México, a los veintisiete días del mes de febrero de 2018.- El Subsecretario de Fomento y Normatividad Ambiental de la Secretaría de Medio Ambiente y Recursos Naturales y Presidente del Comité Consultivo Nacional de Normalización de Medio Ambiente y Recursos Naturales, Cuauhtémoc Ochoa Fernández.- Rúbrica.
 

En el documento que usted está visualizando puede haber texto, caracteres u objetos que no se muestren debido a la conversión a formato HTML, por lo que le recomendamos tomar siempre como referencia la imagen digitalizada del DOF o el archivo PDF de la edición.
 


CONSULTA POR FECHA
Do Lu Ma Mi Ju Vi
crear usuario Crear Usuario
busqueda avanzada Búsqueda Avanzada
novedades Novedades
top notas Top Notas
tramites Normas Oficiales
suscripcion Suscripción
quejas y sugerencias Quejas y Sugerencias
copia Obtener Copia del DOF
Publicaciones relevantes Publicaciones Relevantes
versif. copia Verificar Copia del DOF
enlaces relevantes Enlaces Relevantes
Contacto Contáctenos
filtros rss Filtros RSS
historia Historia del Diario Oficial
estadisticas Estadísticas
estadisticas Vacantes en Gobierno
estadisticas Ex-trabajadores Migratorios
La traducción es automática y puede contener errores o inconsistencias
INDICADORES
Tipo de Cambio y Tasas al 18/09/2018

DOLAR
18.8399

UDIS
6.094032

TIIE 28 DIAS
8.1165%

TIIE 91 DIAS
8.1740%

Ver más
ENCUESTAS

¿Le gustó la nueva imagen de la página web del Diario Oficial de la Federación?

 

0.514386001208453418.gif 0.035783001208452443.gif 0.110712001508857610.jpg 0.192286001221699769.jpg 0.821786001312920061.gif 0.475545001508857915.jpg 0.767714001508856796.jpg
Diario Oficial de la Federación

Río Amazonas No. 62, Col. Cuauhtémoc, C.P 06500, Ciudad de México
Tel. (55) 5093-3200, donde podrá acceder a nuestro menú de servicios
Correo electrónico: dof@segob.gob.mx
Dirección electrónica: www.dof.gob.mx

111

AVISO LEGAL | ALGUNOS DERECHOS RESERVADOS © 2016